Ucsc Failed to Read Index File (.bai) Corresponding to

File Formats

BAM

To load a fix of BAM files merged into a single track see Merged BAM File.

A BAM file (.bam) is the binary version of a SAM file. A SAM file (.sam) is a tab-delimited text file that contains sequence alignment data. These formats are described on the SAM Tools web site: http://samtools.github.io/hts-specs/.

BAM, rather than SAM, is the recommended format for IGV. Starting with IGV 2.0.11, IUPAC ambivalence codes in BAM files are supported.

Indexing: IGV requires that both SAM and BAM files be sorted by position and indexed, and that the alphabetize files follow a specific naming convention. Specifically, a BAM index file should be named by appending .BAI to the bam file proper noun. A SAM index filename is created past appending .SAI.

The alphabetize files must accept the same base file name and must reside in the same directory every bit the file that information technology indexes.
- For example, the index file for test-xyz.bam would be named test-xyz.bam.bai or test-xyz.bai.

Multiple tools are available for sorting and indexing BAM files, including igvtools, the samtools bundle, and in GenePattern. The GenePattern module for sorting and indexing is Picard.SortSam.
SAM files tin can be sorted and indexed using igvtools. Notation: The .SAI alphabetize is an IGV format, and it does non work with samtools or any other awarding.

Chromosome names: Chromosome names must be consistent between the selected reference genome and the SAM/BAM data files. For convenience, IGV equates chromosome numbers and names of the class chr# (e.g., 1 and chr1 are equivalent).

One-based index: Offset and end positions are identified using a one-based index. The terminate position is included. For example, setting beginning-terminate to 1-2 describes two bases, the first and 2nd in the sequence.

BED

BED File Format

A BED file (.bed) is a tab-delimited text file that defines a feature track. It can have any file extension, but .bed is recommended. The BED file format is described on the UCSC Genome Bioinformatics web site: http://genome.ucsc.edu/FAQ/FAQformat. Tracks in the UCSC Genome Browser (http://genome.ucsc.edu/) tin exist downloaded to BED files and loaded into IGV.

Notes:

IGV does not currently support multiple rail lines in a unmarried BED file

Zero-based index: Start and cease positions are identified using a zero-based alphabetize. The end position is excluded. For instance, setting start-stop to 1-ii describes exactly one base, the second base in the sequence.

Display settings: To modify IGV'due south default brandish settings for the BED data, include a runway line in the file.

GFF tag option: By adding a #gffTags line to the commencement of a .bed file, you can add together GFF3-fashion attributes to the Name field (column 4) of a BED file which are displayed in the popup text.

The GFFName holding will get the display proper noun of the feature.
You lot must URL encode spaces and other whitespace (e.g. replace space with %20). This is not a requirement of gff3, rather required considering bed files are whitespace delimited.

Encounter the GFF3 specification, column 9 for more details.

BEDPE

BEDPE File Format

A file format based on the BED format to concisely depict disjoint genome features, such as structural variations or paired-end sequence alignments. Adult by the bedtoolsteam; come across their website for more than details

BedGraph

The BedGraph format allows display of continuous-valued data in track format. This brandish type is useful for probability scores and transcriptome information. This track type is similar to the wiggle (WIG) format, merely unlike the wiggle format, data exported in the bedGraph format are preserved in their original state. For more than information on this file format, see the UCSC Genome Bioinformatics web site description at http://genome.ucsc.edu/goldenPath/aid/bedgraph.html.

Recognized Extension: .bedgraph

bigBed

The bigBed format stores notation items that can either exist simple, or a linked collection of exons, much every bit BED files do. BigBed files are created initially from BED type files, using the UCSC programme bedToBigBed. The resulting bigBed files are in an indexed binary format. The master advantage of the bigBed files is that only the portions of the files needed to display a detail region are transferred, and so for big data sets bigBed is considerably faster than regular BED files.

Go here for more information on bigBed format.

bigWig

The bigWig format is for display of dense, continuous data that will be displayed as a graph. BigWig files are created initially from WIG type files, using the UCSC program wigToBigWig. Alternatively, bigWig files can be created from bedGraph files, using the UCSC program bedGraphToBigWig. In either case, the resulting bigWig files are in an indexed binary format. The main advantage of the bigWig files is that merely the portions of the files needed to display a particular region are transferred, and so for large data sets bigWig is considerably faster than regular WIG files.

Run into here for more information on the bigWig format.

Birdsuite Files

Birdseye Canary Calls

The file extension must be .birdseye_canary_calls an instance file being named:

mycalls.birdseye_canary_calls

The expected file format looks like this:

sample	sample_index	copy_number	chr	outset	end	conviction
1234.CEL	ane	2	1	51598	4639285	1685
1235.CEL	one	3	one	4641859	4649979	0.37
1236.CEL	1	2	ane	4653917	15359041	6038
1237.CEL	i	iii	1	15361772	15362873	0
1238.CEL	1	2	1	15366497	16743865	403.13
1239.CEL	1	3	1	16758722	16808594	0.4

These files are output when Birdsuite is run so there are no additional steps required for these files to load.

broadPeak

A broadPeak (.broadPeak) file is used by the ENCODE project to provide called regions of signal enrichment based on pooled, normalized (interpreted) information. It is a BED 6+3 format. See the UCSC web site for more details on this format.

CBS

A SEG file (segmented data; .seg or .cbs) is a tab-delimited text file that lists loci and associated numeric values.

Meet SEG for details.

Chemical Reactivity Probing Profiles

IGV supports importing chemical reactivity probing profiles from SHAPE or MAP files. After choosing a file to import, the user will exist prompted to select the applicable chromosome and optional strand and starting position. IGV volition so create a .wig file (WIG format) and load information technology.

SHAPE format

The SHAPE format (.shape) is a tab-deliminated text file with 2 columns and no header.

1st column: 1-based nucleotide position
2nd column: chemical reactivity value, or -999 to point positions with no data

Example file:example.shape

MAP format

The MAP format (.map) is output by the SHAPE-MaP software pipeline ShapeMapper. The .map format is identical to the .shape format, with the improver of a third cavalcade containing standard mistake estimates and a fourth column containing the nucleotide sequence. These additional columns are currently ignored by IGV.

Example file:example.map

chrom.sizes

igvtools uses chrom.sizes files to ascertain the chromosome lengths for a given genome. The file format is tab delimited, first column is chromosome name and second is its length. There tin can be more than columns present, merely they are ignored. Files should be named as follows:

<genomdID>.chrom.sizes

For example, hg18.chrom.sizes.

CN

A CN file (.cn) is a tab-delimited text file that contains copy number data. The CN file format is described on the GenePattern web site: http://www.broadinstitute.org/cancer/software/genepattern/gp_guides/file-formats/sections/cn.

Nothing-based index: Physical positions are identified using a zero-based index.

Display settings: To modify IGV'southward default display settings for the CN data, include a track line in the file.

Example: mynah.sorted.cn

Does IGV assume log2(ratio) or absolute values for re-create number?

IGV looks for the presence of negative numbers. If it finds them, it assumes that the data is log2(tumor/normal). If information technology does not find negative numbers, it assumes that the values are absolute, with 2 equally the center. These assumptions are used to set the heatmap legend; the legend tin, notwithstanding, exist changed manually under the View> Color Legends. Instructions are found in the Color Legends section of the user guide.

For data with negative numbers, IGV defaults to a bluish-to-cherry scale that corresponds to copy numbers from -1.five to 1.5. Both deletions and amplifications tin can take continuous valued numbers represented by shading.

Custom File Formats

IGV 2.0 supports custom specification of columns for the ".igv" file format. To use this, include a column specifier directive at the caput of the file. The column directive line starts with #columns, followed past one or more column specifiers of the form cardinal=value. Valid keys are listed in the following table. Columns are tab delimited.

Key	Value
chr	index of the chromosome column (required)
starting time	index of the start position column (required)
end	index of the end position column (optional)
probe	index of a probe or description cavalcade (optional)
data	either a single alphabetize, or a range in the form of 5-10, of the information columns (required)

Note: If a single value is entered for the information column, it is interpreted equally the "outset" information column. All columns starting with this value are assumed to incorporate data. To specify exactly one column, use a range (e.1000., v-5) to specify the 5th column.

Case:

#columns chr=vii start=8 probe=2 data=iv-5 #coords=1
Index TargetID ProbeID_A sample_1_methylation sample_2_methylation genome_build chromosome position
60 cg00002593 25796427 0.7642099 0.7426524 37 1 1258656
21 cg00000957 65648367 0.8172337 0.8323303 37 1 5859840
....

Cytoband

The Cytoband file format is used to define the chromosome ideograms for a reference genome, and/or every bit of version 2.11.0 to create a cytoband rail.

A cytoband file is a 5-cavalcade tab-delimited text file. Each row of the file describes the position of a cytogenetic band. The columns in the file match the columns of the cytoBand table in the database underlying the UCSC Genome Browser. These files are downloadable from the UCSC website equally "cytoBandIdeo.txt.gz" for many genome assemblies, for example https://hgdownload.cse.ucsc.edu/goldenPath/hg38/database/cytoBandIdeo.txt.gz

Cavalcade	Example	Data Type	Description
chrom	chr1	cord	Chromosome
chromStart	0	integer	Get-go position in chromosome sequence
chromEnd	2300000	integer	End position in chromosome sequence
name	p36.33	string	Name of cytogenetic ring
gieStain	gneg	cord	Giemsa stain results. Recognized stain values: gneg, gpos50, gpos75, gpos25, gpos100, acen, gvar, stalk

FASTA

The FASTA file format is used to specify the reference sequence for an imported genome. Each sequence in the FASTA file represents the sequence for a chromosome. The sequence name in the FASTA file is the chromosome name that appears in the chromosome drib-down list in the IGV tool bar. IGV orders the chromosomes based on their names, not their society in the FASTA file.

A FASTA file is a text file. Each sequence begins with a single-line description, followed by lines of sequence data. The unmarried-line description contains a greater-than (>) symbol in the first column, followed by the sequence proper noun. For a consummate clarification of the FASTA file format, run into http://www.ncbi.nlm.nih.gov/blast/fasta.shtml.

Note that FASTA files are merely used for defining reference sequences, they cannot be "loaded" from the file carte du jour.

GCT

A GCT file (.gct) is a tab-delimited text file that contains gene expression data. The GCT file format is described on the GenePattern spider web site: http://www.broadinstitute.org/cancer/software/genepattern/gp_guides/file-formats/sections/gct.

The GCT format is used for gene expression and RNAi data.

Instance: instance.gct

Gene Expression Information

Before IGV tin can display gene expression data, information technology must map the probes named in the file to genomic locations. Unless you specify loci for a probe in the file, IGV uses annotations and mapping files to look up the locations. For information on how gene expression data is mapped, meet Genomic Locations for Probes.

To specify loci for a probe in the file, enter the data into the 2d column as follows:

Name	Clarification	Sample 1	Sample ii
100_g_at	na\|@chr6:1950428-1950681,chr6:2304548-2304574, chr7:18296715-18296752,chr7:41423955-41423981, chr7:48906172-48906198\|	215.37	132.94
101_g_at	na \|@RABGGTA\|	211.iii	90.56

To specify ane locus, use this format: |@chr6:1950428-1950681|. A cistron symbol tin can also be used: |@RABGGTA|

Case:

Proper noun	Clarification	Sample 1	Sample 2
100_g_at	na \|@chr6:1950428-1950681\|	215.37	132.94

To specify more than than i locus, utilise a comma delimited listing: |@chr6:1950428-1950681,chr6:2304548-2304574|
Case:

RNAi Information

GCT files for RNAi data must utilize the .rnai.gct extension.

To display the RNAi information, IGV maps the hairpin names to cistron names, determines the factor locus, and displays the data at that location. The hairpin-to-gene mappings used by IGV are based on piece of work published past Luo, Cheung, Subramanian et al. (PNAS, 2008, 105:51:20380-20385) and available at http://broadinstitute.org/cancer/software/rnai/data/Luo_Cheung_Subramanian_PNAS_2008.chip. The mappings used past IGV are dissimilar simply where a factor name has been modified to match ane used in a genome on the genome server.

CRAM

IGV 2.4 introduces support for sequence alignment data in CRAM 3.0 format. The specification can be found at http://samtools.github.io/hts-specs/CRAMv3.pdf.

A respective index file is required. Past convention, the alphabetize file proper name should be the same every bit the data file name, with ".crai" appended. For example, if the data file is named example_xyz.cram, the index file should be named example_xyz.cram.crai or example_xyz.crai.

genePred

The genePred tabular array formats can be used to specify the gene track annotations for an imported genome.

Several variations of the genePred tabular array format are described in the FAQ titled "genePred tabular array format" on the UCSC Genome Browser web site: http://genome.ucsc.edu/FAQ/FAQformat#format9. Downloading factor information from any of these tables creates a tab-delimited text file where the columns in the file match the columns in the table. Downloaded files may be zipped with a .txt.gz extension. Such a zipped file can be used to specify the gene track annotations for an imported genome. IGV looks for specific string in the filename (case insensitive) to identify the file format:

File Name Contains	Description
ucscGene	Columns in the file match the columns in the table, as described in the "Gene Predictions" section of the genePred table format FAQ.
genePredExt refGene ensGene	These files have the same format. Columns in the file friction match the columns in the table, every bit described in the "Gene Predictions (Extended)" department of the genePred table format FAQ. Notation: The first cavalcade of this file holds an integer, which is non documented in the FAQ and is ignored by IGV.
refFlat	Columns in the file friction match the columns in the table, as described in the "Gene Predictions and RefSeq Genes with Gene Names" section of the genePred table format UCSC FAQ.

GFF/GTF

A General Feature Format (GFF) file is a simple tab-delimited text file for describing genomic features. At that place are several slightly but significantly different GFF file formats. IGV supports the GFF2, GFF3 and GTF file formats.

GFF2 files must accept a .gff file extension for IGV. See the Wellcome Trust Sanger Institute web site (http://www.sanger.ac.uk/Software/formats/GFF/GFF_Spec.shtml) for a description of the GFF2 file format.
GFF3 files must have a .gff3 file extension for IGV. See the Sequence Ontology Projection (SO) web site (http://www.sequenceontology.org/gff3.shtml) for a description of the GFF3 file format.
GTF files must have a .gtf file extension for IGV. See the Computational Genomics Laboratory web site (http://mblab.wustl.edu/GTF2.html) for a description of the GTF file format.

I-based index: Showtime and end positions are identified using a 1-based index. The end position is included. For case, setting showtime-stop to 1-2 describes two bases, the first and second in the sequence.

Display settings: To modify IGV'due south default display settings for the .gff or .gff3 data, include a track line in the file.

Characteristic brandish name:To override the default setting for which field is used to characterization the features in the IGV track, add the following line to the file:

##displayName=<field name>

Coloring features: To specify a colour for a given feature, yous can add this to the file as shown in the post-obit example. Color values can be in either hexadecimal or RGB (r, k, b) format.

##gff-version 3
chr1 varclass variants_454HCDiffs 59133 59133 33 . . Var=A->G;AA=South->S;depth=9;frame=+1;factor=OR4F5;ref=novel;InRegion;color=#0000EE
chr1 varclass variants_454HCDiffs 59374 59374 67 . . Var=A->One thousand;AA=T->A;depth=30;frame=+one;gene=OR4F5;ref=rs2691305;InRegion;color=#EE0000
chr1 varclass variants_454HCDiffs 731442 731442 100 . . Var=T->C;AA=->;depth=3;frame=;gene=;ref=rs3115865,rs61770168;OutOfRegion;color=#AAAAAA

GISTIC

A GISTIC file (.gistic) is the Gistic Scores File output from the GenePattern GISTIC module. Information technology is a tab-delimited text file that defines a feature track displaying the q-value for regions of distension or deletion found using GISTIC (Beroukhim et al., 2007). The first row contains eight column headings, which must exist identical to those listed in the post-obit table. Each subsequent row defines a GISTIC characteristic.

IGV displays GISTIC deletion scores every bit a blue line and amplification scores as a red line:

Example: scores.gistic

Column Heading	Description
Blazon	Aberration type, which is specified every bit Amp or Del (amplification or deletion)
Chromosome(hg17)	Chromosome
Start	Location of the first base pair in the aberrant region
End	Location of the last base pair in the aberrant region
q-value	Simulated Discovery Rate q-values for the aberrant regions (q-values beneath a user-defined threshold are considered significant)
score	G-score that considers the amplitude of the aberration likewise as the frequency of its occurrence across samples
amplitude	Average amplitudes amid aberrant samples
frequency	Frequency of aberration across the genome for both amplifications and deletions

Goby

IGV ii.0 integrates support for Goby NGS file formats. Goby is an NGS information direction framework designed to facilitate the implementation of efficient data assay pipelines. Information technology provides efficient file formats to store NGS data and intermediary analysis results.

IGV two.0.4 renders Goby alignments with lines connecting parts of reads that span exon-exon junctions. Alignments with splicing information can be generated for RNA-Seq information with GSNAP compiled with Goby support. Splicing information is automatically detected when present and displayed. See example here.

IGV supports Goby coverage data .counts files.

For more data on these file formats, see the Goby NGS Framework Web site. For details on current and planned Goby back up in IGV see the IGV development wiki.

GWAS

A GWAS file is a infinite- or tab-delimited effect file from genome-wide association study (GWAS) analysis. These files include PLINK result files containing integrated map information (i.east., chromosomal location for each association).

File extensions for GWAS files are: .linear, .logistic, .assoc, .qassoc, .gwas

GWAS file must contain a header line and iv required columns (example-insensitive):

CHR: chromosome (aliases chr, chromosome)
BP: nucleotide location (aliases bp, pos, position)
SNP: SNP identifier (aliases snp, rs, rsid, rsnum, id, marker, markername)
P: p-value for the clan (aliases p, pval, p-value, pvalue, p.value)

Columns can exist in any lodge. Other columns besides the required ones are allowed and volition be included in popup text. The p-value will be transformed to -log10 calibration for plotting.

IGV

An IGV file (.igv) is a tab-delimited text file that defines tracks. The first row contains column headings for chromosome, beginning location, stop location, and characteristic followed by the proper name of each track defined in the .igv file. Each subsequent row contains a locus and the associated numeric values for each rail. IGV interprets the beginning iv columns every bit chromosome, starting time location, cease location, and feature name regardless of the column headings in the file. IGV uses the column headings for the fifth and subsequent columns every bit track names. Feature names are not displayed in IGV.

For instance:

Chromosome	Start	End	Feature	Patient-One	Patient-Two	Patient-3
chr1	2150459	2150460	Test_one	0.01	0	0.99
chr1	3558044	3558045	Test_two	0.25	0.71	1.31

Aught-based alphabetize: Commencement and terminate positions are identified using a goose egg-based index. The finish position is excluded. For instance, setting start-end to 1-2 describes exactly ane base, the second base in the sequence.

Data must be grouped by chromosome and inside each chromosome group sorted by start position: The igvtools bundle bundle tin can be used to sort .igv files.

Display settings : IGV displays IGV file data using default display settings. To modify the default brandish settings for the data, you can:

Include a type line in the file to make IGV use the display settings for a different data blazon.
Include a track line in the file.

LOH

An LOH file (.loh) is a copy number file that contains "loss of heterozygosity" values. The format is identical to the CN format, simply the numbers accept the post-obit meanings:

-1: Conflict (homozygous in the normal and heterozygous in the tumor)
0: Retained
1: Loss of heterozygosity

Numbers that fall between these values represent the probability of LOH. IGV treats the values as a continuum and colors them according to the heatmap scale set for the LOH track.

Display settings: To modify IGV's default display settings for the LOH data, include a track line in the file.

MAF (Multiple Alignment Format)

The Multiple Alignment Format stores a serial of multiple alignments. See the UCSC spider web site for more details. The extension must be ".maf".

Note: .maf files must exist indexed, and in plain text (non gzipped) with a .maf extension. IGV will create an index for the file on starting time use, which will result in a delay in loading. Practice not close IGV while indexing is in progress.

MAF (Mutation Annotation Format)

A Mutation Annotation Format (MAF) file (.maf) is a tab-delimited text file that lists mutations. The format is described in detail at the NCI'south Genomic Data Commons documentation site hither.

Merged BAM File

A set of BAM files can now be loaded merged into a single rails. If each file contains unlike Sample or Read Group tags, every bit specified in the SAM/BAM file format, then the merged runway tin can be sorted by these to differentiate the origins of reads to these files within a single track.

Create a text file containing a list of the BAM files y'all want to load, listed by either file path or URL. IGV will load all the BAM files equally a single track.

This file must exist in plain text format with .txt extension. Rich text format will cause an fault.
For older versions of IGV, be sure there is not an extra line at the bottom of the list. This causes an fault.

If IGV gives an error "Error loading.... Cannot find reader for alignment file" run across here.

Required Extension: .bam.list

MUT

See Viewing Variants for example IGV visualizations of mutation and related VCF files. For details on how to display mutations in IGV, see Mutation Files.

A MUT file (.mut) is a tab-delimited text file that lists mutations. The first row contains column headings and each subsequent row identifies a mutation. IGV ignores the column headings. It reads the first five columns as shown below and ignores all subsequent columns:

chromosome
start location (location of the start base pair in the mutated region)
end location (location of the last base pair in the mutated region)
sample or patient ID
mutation type (for example, Synonymous, Missense, Nonsense, Indel, etc.)

Example: example.mut

When a specific mutation is moused-over or clicked on, depending on user IGV brandish settings, a mutation information panel displays the information provided in all the columns of the MUT file, in order, for the particular mutation. For more than ~fifty columns of information, only a subset of the data is displayed.

narrowPeak

A narrowPeak (.narrowPeak) file is used by the ENCODE project to provide called peaks of point enrichement based on pooled, normalized (interpreted) data. It is a BED half dozen+four format. Meet the UCSC web site for more detail on this format.

PSL

A PSL file (.psl) is a tab-delimited text file that represents alignments, and are typically taken from files generated by BLAT or psLayout. The PSL file format is described on the UCSC Genome Bioinformatics web site: http://genome.ucsc.edu/FAQ/FAQformat.

RES

A RES file (.res) is a tab-delimited text file that contains gene expression data. The GCT and RES files are the aforementioned, except that the RES file format contains labels for each gene'due south absent (A) versus present (P) calls every bit generated by Affymetrix's GeneChip software. The RES file format is described on the GenePattern web site: http://www.broadinstitute.org/cancer/software/genepattern/gp_guides/file-formats/sections/res. Meet GCT File Format for a discussion of how IGV determines the loci for the gene expression data.

RNA Secondary Structure Formats

BP (RNA base pairing)

A BP file (.bp) is text file format that describes connections betwixt ranges of nucleotides, and is primarily used to indicate base of operations pairing interactions or estimated pairing probabilities for RNA structures. BP files are rendered in IGV using colored semicircular arcs.

File Header.A file begins with any number of header lines listing all arc colors and associated labels. Each of these lines are tab-delimited, and must brainstorm with "color", followed by the red, green, and blue color components 0-255, followed by an optional text label which will be shown in the rail carte color fable. Arc colors will exist rendered in listed gild (i.e. the last listed color will be drawn on top). Track lines are not currently supported for this file type.

Example header line:color: 51 114 38 High-probability basepairs

Paired Ranges.Each tab-delimited line in the rest of the file describes a single arc. The first field is the name of the associated IGV chromosome. The last field is a zero-based integer index indicating the arc color (from the colors listed in the header). The second through 5th fields are the 1-based inclusive nucleotide coordinates of paired ranges (a helix, if this is an RNA structure).

Example BP file: instance.bp

The following RNA secondary construction formats can be imported into IGV and converted to the .bp format. After choosing a file to import, the user volition exist prompted to select the applicable chromosome and optional strand and starting position. IGV will then create a .bp file and load it.

DB (dot subclass)

DB (dot bracket) format (.db, .dbn) is a patently text format that can encode secondory structure. Lines beginning with > or # are currently ignored. Nucleotide sequence is currently ignored.

Secondary structure notation:

Unpaired nucleotides are indicated with the . or : characters.
Matching pairs of parentheses indicate base pairs.
To indicate not-nested base pairs (pseudoknots), additional brackets may be used: [], {}, or <>.

Files containing multiple sequences or structures are currently not supported.

Example:

GGUGCAUGCCGAGGGGCGGUUGGCCUCGUAAAAAGCCGCAAAAAAUAGCAUGUAGUACC ((((((((((((((.[[[[[[..))))).....]]]]]]........)))))...))))

CT (connectivity table)

The CT format (.ct) is used by software packages such as RNAstructure. See the CT File Format on the Mathews Lab web folio.

Merely the start structure in a CT file volition be imported by IGV. CT files with boosted headers (often starting with the # character) are currently non supported.

Case CT file:example.ct

DP (dot plot or pairing probability)

The DP file format (.dp) can be generated using the RNAstructure software package by running partition followed by ProbabilityPlot on the resulting .pfs file with the -t pick for text file output. For modeling the structures of large mRNAs, the program Superfold runs division on multiple overlapping windows, then heuristically merges the windows. Superfold outputs a merged .dp file past default.

File format:

1st line is the number of entries in the file.
2nd line is column names.
Remaining lines depict pairing probabilities betwixt one-based nucleotide positions, given every bit tab-separated

Upon import, IGV colors pairs above 80% probability nighttime green. Pairs betwixt 30 and 80% probability are colored blue. Pairs between ten and 30% probability are colored calorie-free yellow.

Other

IGV besides supports viewing RNA secondary structures in BED format.

SAM

For detailed specifications, we refer yous to the September 2022 commodity titled Sequence Alignment/Map Format Specification by the SAM/BAM Format Specification Working Group, and the Samtools site.

For information on the related binary version of SAM, meet BAM.

The citation for the 2009 Bioinformatics paper introducing the SAM format follows:

Li H.*, Handsaker B.*, Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis Thousand., Durbin R. and chiliad Genome Project Data Processing Subgroup (2009) The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics, 25, 2078-nine. [PMID: 19505943]

Sample Info (Attributes) file

Sample information files includes Attributes files, Sample Mapping files, Attribute Color files, and files that combine information. These are tab-delimited text files with extension .txt. You load them as you would data files, via the File menu. IGV can load multiple sample data files per session.

When loaded into IGV, attributes display in a separate color-coded panel between sample names and tracks. Meet Sample Attributes and Sorting, Grouping, and Filtering for more than information on displaying attributes and using attributes to manipulate tracks. IGV automatically assigns colors and heatmaps to attribute data values and what it determines are data ranges.

This page has the post-obit sections.

Overview of sample data file types
Attributes files include descriptive information such every bit annotations or metadata for tracks.
Sample Mapping files friction match sample identifiers beyond datasets.
Optionally assign specific Aspect Colors, including heatmap ranges.

Sample information files allow integrating various data tracks from the same sample or patient.

Tracks can exist grouped based on the value of an attribute from the sample information file, such equally a patient identifier. See the example in the Attributes files section.
Similarly, utilize to comment VCF sample rows with metadata and let grouping.
Sample information files tin can be used to overlay mutation tracks on other information tracks, east.g. expression or copy number data.

Overview of sample data file types

Consider your data visualization needs equally the various sample information sets allow for dissimilar features of IGV. The decision tree table below matches use cases to the Sample Information file types.

Aspect, mapping, and color information may be in separate files, i.e. in Attributes files, Mapping files, and Color files, or in a single Sample Information file.

To salvage all iii types of information in a single file, listing attributes first, then mapping, and and so color.
- Between the information types, separate sections with row headers #sampleMapping and #colors.
- Empty rows are not necessary and are ignored.
To differentially overlaying mutation tracks while still assigning attributes across data types, utilise a Modified Attributes file.

When loading attributes for datasets where sample names are identical across file types, no mapping information is necessary for the attributes to utilise to the multiple data blazon tracks. Withal, to apply the same attribute information across datasets where sample names differ, you can use either of ii different types of Sample Data sets every bit indicated by (b) and (c) in the table.

Multiple information track types?
No		Aye
Practice attributes sample labels match information track sample names?
No. (a) Edit Attributes file to include the matching information track sample names in the beginning column. (b) Load Attributes and Sample Mapping information.	Aye. Attributes utilise to information tracks.	No. (b) Load Attributes and Sample Mapping data. (c) Utilise Modified Attributes file that integrates mapping information. This format allows differential overlay of mutation tracks.	Aye. Attributes apply to information tracks.

Attributes

An Attributes file lists track identifiers in the first cavalcade and attributes in subsequent columns with a single header row. IGV matches the track identifiers in a data file with the track identifiers in the Attributes file.

Instance 1: exampleSampleInfo.txt
Example 2: BLCA_ClinicalAttributes.txt

For example, load the second case file on top of IGV hg19'southward CopyNumber: [genome_wide_snp_6__broad]. This data is constitute in the hosted server data The Cancer Genome Atlas>TCGA Broad GDAC>Firehose Standard Data>Broad Firehose Standard Data Run: 2015_02_04>BLCA-TP. Applying attributes to the data file allows sorting by copy number for the 22q13:32 loci and the pathology.M.stage attribute as shown in the Screenshot (2015.03.05) below.

Acceptable variations to the Attributes file

Then long as the first row contains attribute labels and the get-go column sample names, the remaining rows may contain information pertaining to samples in any information type and be organized in whatsoever style.

Because IGV tin can load multiple Attributes files per session, it is not necessary to merge attributes into a unmarried file.
Attributes only apply to data tracks with matching names. Aspect rows without matching data tracks practice not display. So the information within the Attributes file demand not overlap exclusively to the data tracks.
For information tracks without a matching attribute row, respective IGV attributes panel rows remain blank.

In the example of different data sets with unlike sample names from the same individual, e.g. copy number and RNA expression, you lot may wish to apply the information inside a single attributes file in duplicate to the different data types. In this case, you may (b) additionally load a Sample Mapping file as outlined in the next section or (c) alter your Attributes file as outlined beneath.

For a single attributes file, duplicate the attributes by re-create-pasting into empty rows, then modify sample names in the first column as needed for the differentially named datasets.

For multiple attributes files, indistinguishable the entire file and open up each to alter sample names for the differentially named datasets as needed.

The Modified Attributes file includes a column indicating a linking identifier for utilise in mutation overlay.

Sample Mapping

A Sample Mapping department begins with the line #sampleMapping and maps track identifers to sample identifiers. It is useful in cases where these identifiers might differ. For example, one might map the runway identifier "foo.bam" to sample identifier "foo_sample". The format is 2 cavalcade tab delimited, the first column is the track identifier, second the sample identifier.

Aspect Colors

By default, IGV randomly assigns colors to the attribute values. You lot can optionally specify the colors for aspect values in RGB format for a specific label, a specific value, or as a heatmap scale for numeric columns in monocolor or in two-color heatmap for specified ranges. Customize colors using either a divide Attribute Colors file or by adding a colors section to the end of a Sample Data file. Colors information is tab-delimited with three or four columns as shown in the instance below.

column 1	cavalcade two	column 3	column 4 (optional)
Indicates attribute name	Indicates attribute value or attribute range separated by a colon (:)	Indicates color in RGB format. If used with column 4, then is the first color of a 2-color heatmap	Specifies the second color in RGB format in a two-color heatmap for aspect ranges
Example				Explanation
#colors
GENDER	MALE	0,0,155		a value of "Male person" for the "GENDER" column gets the color (0,0,155)
*	Classical	80,180,80		a value of "Classical" in any cavalcade gets the color (eighty,180,fourscore)
KarnScore	*	0,0,255		numeric column instance, monocolor heatmap
% Tumor Nuclei	xc:100	0,0,255		another monocolor heatmap, this time with the range specified
sil_width	-0.1:0.v	0,0,255	255,0,0	a ii-color heatmap with the range specified

Colors information, either file or section, must exist headed past a row with #colors.
An asterisk (*) in either of the first 2 columns indicates a wildcard.
RGB values are separated by commas (,) without spaces and may exist listed inside double quotations, eastward.g. 0,0,155 or "0,0,155".

Look up RGB values by colour wheel at https://color.adobe.com/create/colour-wheel/. Alternatively look up RGB values on a chart at http://world wide web.rapidtables.com/spider web/color/RGB_Color.htm.

Briefly, RGB (cerise, green, and blue light) refers to a organisation of representing colors for computer display with nil representing absence and 255 giving maximum lite for a color in comma-separated values. Example color RGB values are given beneath.

Red	255,0,0
Dark-green	0,255,0
Blue	0,0,255
Yellow	255,255,0
Magenta	255,0,255
Cyan	0,255,255
Black	0,0,0
White	255,255,255

SEG

A SEG file (segmented data; .seg or .cbs) is a tab-delimited text file that lists loci and associated numeric values. The start row contains column headings and each subsequent row contains a locus and an associated numeric value. IGV ignores the column headings. It reads the first 4 columns equally track name, chromosome, first location, and end location. It reads the terminal column equally the numeric value for that locus (if the value is non-numeric, IGV ignores the row). IGV ignores all other columns.

The segmented data file format is the output of the Circular Binary Partitioning algorithm (Olshen et al., 2004).

Example: example.seg

Display settings: IGV displays segmented information files using the default runway display settings for the copy number data blazon (encounter Default Display). To have IGV use the display settings for a unlike data type, include a blazon line in the segmented information file.

TDF

A tiled data file (TDF) file (.tdf) is a binary file that contains data that has been preprocessed for faster display in IGV.

Generate TDF files past using the igvtools parcel (toTDF command).

Track Line

When IGV loads a data file, it uses the file extension to determine the file format, the file format to determine the information type, and the data type to make up one's mind the default display options (see Default Display). Adding a runway line to a information file modifies IGV'south default display options. This can be especially useful for file formats not associated with any particular type of data, such every bit the IGV file format.

The following file formats allow track lines:

BED, WIG, PSL
IGV, CN, SNP, GFF, LOH, GFF3, SEG -- in these file formats, the runway line must brainstorm with a # symbol; i.e. #track

IGV track lines are based on WIG rails lines. See the UCSC site for the WIG track line syntax: https://genome.ucsc.edu/goldenPath/help/jerk.html. The following table describes the track line specifiers that IGV supports. IGV includes a few options that are non part of the UCSC specification.

Note: IGV does not currently support multiple track lines in a unmarried file.

Specifier	Value	Clarification
name	trackLabel	Runway proper name (ignored when used in the IGV file format)
clarification	centerlabel	Currently ignored
visibility	full \| dense \| hide	Currently ignored
color	RRR,GGG,BBB	Color for positive values in all tracks
altColor	RRR,GGG,BBB	Color for negative values in all tracks
priority	Due north	Currently ignored
autoScale	on\|off	Currently ignored. All tracks autoscale unless an explicit data range is defined (east.chiliad., by including the viewlimits specifier).
gridDefault	on \| off	Currently ignored
maxHeightPixels	max:default:min	default and min are supported max is currently ignored
graphType	bar \| points \| heatmap	Graph blazon to use: chart \| besprinkle plot \| heatmap. (IGV only: The heatmap value is an IGV addition to the specification.)
midRange (IGV extension)	x:y	Defines the neutral range for a iii-colour heatmap. Values in this range are rendered with the midColor value, which is white past default. Case: midRange=20:80
midColor (IGV extension )	RRR,GGG,BBB	Color to use in the "mid range" of a heatmap. Example: midColor=0,0,150
viewLimits	lower:upper	Defines the information range
yLineMark	real-value	Currently ignored
yLineOnOff	on \| off	Currently ignored
windowingFunction	maximum \| minimum \| hateful \| none	Function that summarizes the values in a window of information represented by one pixel
smoothingWindow	off \| [2-16]	Currently ignored
url		Defines a URL for an external link associated with this rail. Whatever '$$' in this string this will exist substituted with the item name.
coords (IGV extension)	0 \| 1	Indicate whether the file uses 0 or 1 based coordinates. The UCSC specification for WIG files uses 1 based coordinates and for BED files uses 0 based coordinates. If data looks off by ane, check for a possible 0 vs 1 based coordinate issue.
scaleType (IGV only)	log \| linear	The Y-axis scale type for charts
featureVisibilityWindow (IGV just)	integer value	The window size in bp beneath which features are loaded and displayed. When the viewing window is higher up this value a message is displayed "Zoom in to view features". This parameter is useful for large indexed feature tracks. A negative value signal features should be loaded for an entire chromosome (but non the whole genome)
gffTags (IGV extension)	off \| on	If "on" the name field is treated equally a GFF3 style aspect list (column nine of GFF3). The default is "off".

Blazon Line

When IGV loads a data file, it uses the file extension to determine the file format, the file format to determine the data blazon, and the data type to make up one's mind the default display options (see Default Display). In the IGV and segmented (SEG, CBS) file formats, you tin utilise a #type line to override the default data type and thus the default display options. For instance, the IGV file format has a default data type of 'Other' and, therefore, the information in file is displayed using a blue bar chart with an autoscaled data range. By adding a #type line to the IGV file, you tin can bespeak that the file contains factor expression data; in which case, the data will be displayed using a blueish-to-cherry-red heatmap with the data range gear up from -i.5 to i.five.

The #blazon must be the start line in the file. It has the following format:

#blazon=data-type

where data-type is one of the post-obit (these values are case-sensitive): COPY_NUMBER, GENE_EXPRESSION, CHIP, DNA_METHYLATION, ALLELE_SPECIFIC_COPY_NUMBER, LOH, RNAI

The selected data type determines the display settings (see Default Display).

VCF

VCF stands for Variant Telephone call Format, and information technology is used by the 1000 Genomes project to encode structural genetic variants. See Viewing Variants for example IGV visualizations of mutation and VCF files.

Variant calls include SNPs, indels, and genomic rearrangements.
Samples may besides exist annotated with attribute information, including pedigree and family information. IGV uses these annotatations to group, sort, and filter samples, eastward.g. to grouping samples past population grouping.

A consistent colour sheme is used in the variant display row, which is the pinnacle row, for files with or without geneotypes.

blue - minor allele frequency/fraction is known from annotation or genotype data
grey - minor allele frequency is not known
red - peak is proportional to minor allele frequency

Required Extensions: .vcf, .vcf.gz

If the file is gzipped (ends with .vcf.gz), information technology must have an accompanying Tabix index (come across below).

VCF Requirements

IGV supports VCF Version 4.

VCF data files must be indexed for viewing in IGV, either by using igvtools or past using Tabix.

igvtools can be run from the command line or IGV itself (Tools>Run igvtools...) After launching, cull theIndexcommand and scan to your .vcf file. The alphabetize file (.idx) will be created in the aforementioned directory equally the .vcf file.
- igvtools also sorts .vcf files.
Tabix creates a .tbi file. Tabix, including documentation, is available from the SamTools Web site.

Load a BAM track for a sample in a VCF file

Display reads associated with a variant genotype in a VCF file past associating BAM files with samples in a VCF file.

Associate BAM files with samples in the VCF file using a 2 column tab-delimited mapping file.

The filename must be <vcf file proper name>.mapping. In other words add together .mapping to the end of the vcf file name.
The outset column is the sample name from the vcf file, the second the path to the bam file. The bam file path can exist a URL or file path, and it can be either absolute or relative to the path to the vcf file.
If the mapping file is present it will be loaded automatically, and a new menu item will appear in the VCF track called "load alignments".

VCF Specification

The v4.0 specifications: http://world wide web.1000genomes.org/wiki/doku.php?id=1000_genomes:analysis:vcf4.0
v4.1 specifications: http://samtools.github.io/hts-specs/VCFv4.1.pdf
v4.2 specifications: http://samtools.github.io/hts-specs/VCFv4.2.pdf

Example V.4.0 File:

##fileformat=VCFv4.0
##fileDate=20090805
##source=myImputationProgramV3.1
##reference=1000GenomesPilot-NCBI36
##phasing=fractional
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data">
##INFO=<ID=DP,Number=ane,Type=Integer,Description="Total Depth">
##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency">
##INFO=<ID=AA,Number=one,Type=String,Description="Ancestral Allele">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129">
##INFO=<ID=H2,Number=0,Type=Flag,Clarification="HapMap2 membership">
##FILTER=<ID=q10,Description="Quality below 10">
##FILTER=<ID=s50,Description="Less than 50% of samples accept data">
##FORMAT=<ID=GT,Number=one,Type=Cord,Description="Genotype">
##FORMAT=<ID=GQ,Number=1,Blazon=Integer,Description="Genotype Quality">
##FORMAT=<ID=DP,Number=1,Blazon=Integer,Description="Read Depth">
##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003
20 14370 rs6054257 Thousand A 29 Laissez passer NS=iii;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:ane:51,51 i|0:48:8:51,51 1/1:43:five:.,.
20 17330 . T A 3 q10 NS=three;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:iii
20 1110696 rs6040355 A Thousand,T 67 Pass NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ ane|2:21:6:23,27 ii|i:2:0:18,2 ii/2:35:4
20 1230237 . T . 47 Pass NS=iii;DP=13;AA=T GT:GQ:DP:HQ 0|0:54:seven:56,60 0|0:48:four:51,51 0/0:61:2
20 1234567 microsat1 GTCT G,GTACT 50 Laissez passer NS=3;DP=9;AA=G GT:GQ:DP 0/1:35:4 0/2:17:2 1/one:40:3

This case shows in order:

A good, simple SNP
A possible SNP that has been filtered out considering its quality is below 10
A site at which two alternate alleles are chosen, with 1 of them (T) being ancestral (possibly a reference sequencing mistake)
A site that is called monomorphic reference (i.e., with no alternate alleles),
A microsatellite with ii alternative alleles, one a deletion of 3 bases (TCT), and the other an insertion of i base (A).

Genotype data are given for three samples, two of which are phased and the third unphased, with per sample genotype quality, depth, and haplotype qualities (the latter only for the phased samples) given equally well equally the genotypes. The microsatellite calls are unphased.

WIG

A WIG file (.wig) is a text file that defines either a feature or data track. It must have a .wig file extension for IGV to read it as a wiggle file. The WIG file format is described on the UCSC Genome Bioinformatics web site: http://genome.ucsc.edu/FAQ/FAQformat.

For faster loading, convert WIG files to bigWig format. Alternatively, convert to TDF format using IGVTools.

Notes;

IGV does not currently support multiple rails lines in a unmarried WIG file

1-based index: Start and end positions (for "fixedStep" and "variableStep" formats) are identified using a ane-based index. The terminate position is excluded. For example, setting starting time-terminate to 1-ii describes exactly one base of operations, the kickoff base of operations in the sequence.

Display settings: To change IGV's default display settings for the WIG file data, include a track line in the file.

stampcancest2002.blogspot.com

Source: http://software.broadinstitute.org/software/igv/?q=book%2Fexport%2Fhtml%2F16